Zeb2 Glioma

The ZEB1 Pathway Links Glioblastoma Initiation, Invasion And ...
The ZEB1 pathway links glioblastoma initiation, invasion and chemoresistance Florian A. Siebzehnrubl1*, Daniel J. Silver1y, Bugra Tugertimur1y, Loic P. Deleyrolle1y, glioma; xenograft DOI 10.1002/emmm.201302827 Received April 02, 2013 Revised May 02, 2013 ... Fetch Doc

MiR-139-5p Suppresses Cancer Cell Migration And Invasion ...
MiR-139-5p suppresses cancer cell migration and invasion through targeting ZEB1 and ZEB2 in GBM to be localized on the surface of glioma cells, where it could ... Read Full Source

Mowat Wilson Syndrome: The First Report Of An Association ...
The first report of an association with central nervous system tumors ZEB2 mRNA is detected in nearly all human tissues, but tumor was an aggressive high-grade glioma (GBM) that oc-curred 10 years later. ... Return Document

ZEB2 Zinc-finger Missense Mutations Lead To Hypomorphic ...
ZEB2 zinc-finger missense mutations lead to hypomorphic alleles and a mild Mowat-Wilson syndrome Jamal Ghoumid1,2,3, ZEB2, first identified as a partner of SMAD1, has been shown to be a key protein of the TGF-beta and BMP pathways (8, 9). ... Return Doc

Contents Lists Available At ScienceDirect Cancer Epidemiology
Zeb2 are highly correlated with the mesenchymal and drug-resistant phenotypes of cancer cells [29]. Nevertheless, over- glioma patients, miR-200b expression did not significantly correlate with shorter progression-free survival and overall ... Read Content

Role Of Androgen Receptor In Epithelial To Mesenchymal ...
Invasion in glioma cells (Qi et al., 2012) ZEB2 directly binds proximal E boxes within the E-cadherin gene and mediates transcriptional ZEB2 over-expression restores invasion in AR over-expressing androgen independent prostate cancer cell lines ... Doc Retrieval

Axl Is An Essential Epithelial-to-mesenchymal Transition ...
Axl is an essential epithelial-to-mesenchymal transition-induced regulator of breast cancer metastasis and patient survival xenograft growth of breast carcinoma and glioma cells (12, 13). Zeb2 and Snail family transcription factors are all associated ... Return Doc

Epithelial-to-mesenchymal(-like) Transition As A Relevant ...
Epithelial-to-mesenchymal(-like) transition as a relevant molecular ZEB1/ZEB2 and SNAIl1/SNAIl2 as inducers for cell-invasiveness glioma cell invasion by modulating MMP-14 and uPAR expression via HOXD10, Brain Res. 1389 ... Retrieve Here

Differential Expression Of MiR200a-3p And MiR21 In Grade II ...
Glioma progression. Interplay between miR200a and MGMT should be considered as potential mechanism involved in therapeutic response. EMT by repressing the expression of ZEB1 and ZEB2 (SIP1).65 Thus, we suggest that accumulation of O6-MeG adducts in cells ... Retrieve Full Source

Supplemental Table 1. MicroRNAs Regulated By ZEB1.
Supplemental Table 1. MicroRNAs regulated by ZEB1. glioma (19) induced by TGF , enhances MMP2/9 activity and promoted induces growth inhibition and apoptosis, and inhibits invasion Zeb2 AGGCGCGAGAGAAAGGGCAC CCCGGTTCATCAGCAGCTCGG ... Return Doc

User:jinchao Yu/sandbox - Wikipedia, The Free Encyclopedia
User:jinchao Yu/sandbox. miR-138; Conserved secondary structure of miR-138 prescursor: Identifiers; Symbol: miR-138: Rfam: miRBase: miRBase family: Entrez: HUGO: Other data: RNA type: miRNA: Domain(s) Animalia: Locus: Chr. 3: miR-138 is a family of microRNA precursors ... Read Article

Mir-221 MicroRNA - Wikipedia, The Free Encyclopedia
In molecular biology mir-221 microRNA (and its paralogue, mir-222) is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. ... Read Article

Epithelial‑mesenchymal Transition In Glioblastoma Progression ...
Such phenotypic diversity in glioma tissues may be caused by various microenvironmental factors, as well as intrinsic genetic alterations. high levels of ZEB2 demonstrated significantlyearlier recur-rence with malignant transformation compared to those with ... Retrieve Here

Activation Of Hypoxia Signaling Induces Phenotypic ...
Activation of hypoxia signaling induces phenotypic transformation of glioma cells: implications for bevacizumab antiangiogenic therapy Zeb2, Snail, Slug and Twist. Sections taken 5 cm away from the tumor mass ... Read Full Source

Gene Section - Documents.irevues.inist.fr
Glioma Disease Tumors that arise from the glial cells, the most common site is the brain. FOXQ1 and ZEB2 expression correlated positively in hepatocarcinoma samples but inversely with CDH1. FOXQ1 induced metastasis through ... Retrieve Document

Identification Of The Role Of Smad Interacting Protein 1 (SIP1 ...
Identification of the role of Smad interacting protein 1 (SIP1) in glioma known as ZEB2) in glioma. We firstly found that SIP1 expression was high in four tumorigenic glioma cell lines but low in two nontumorigenic glioma cell lines. By ... Document Viewer

Tumor Necrosis Factor Modulates Epithelial Mesenchymal ...
Tumor necrosis factor-α modulates epithelial mesenchymal transition mediators ZEB2 and S100A4 to promote cholangiocarcinoma progression glioma cells or surrounding astrocytes affects migration of tumor ... Read Content

Int6/eIF3e Is Essential For Proliferation And Survival Of ...
Transition increasing Snail and Zeb2 expression [19]. Finally, Int6 modulates HIF-2α expression and its target genes to control vascular remodeling and development responses of glioma cells to Int6 inhibition requires clarifications but could potentially be explained by ... Fetch This Document